Creation

The Origin of Life / The Future of Life

Author: Adam Rutherford

Publisher: Penguin UK

ISBN: 0141970227

Category: Science

Page: 272

View: 551

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Leben 3.0

Mensch sein im Zeitalter Künstlicher Intelligenz

Author: Max Tegmark

Publisher: Ullstein Buchverlage

ISBN: 3843716706

Category: Social Science

Page: 528

View: 9423

Die Nobelpreis-Schmiede Massachusetts Institute of Technology ist der bedeutendste technologische Think Tank der USA. Dort arbeitet Professor Max Tegmark mit den weltweit führenden Entwicklern künstlicher Intelligenz zusammen, die ihm exklusive Einblicke in ihre Labors gewähren. Die Erkenntnisse, die er daraus zieht, sind atemberaubend und zutiefst verstörend zugleich. Neigt sich die Ära der Menschen dem Ende zu? Der Physikprofessor Max Tegmark zeigt anhand der neusten Forschung, was die Menschheit erwartet. Hier eine Auswahl möglicher Szenarien: - Eroberer: Künstliche Intelligenz übernimmt die Macht und entledigt sich der Menschheit mit Methoden, die wir noch nicht einmal verstehen. - Der versklavte Gott: Die Menschen bemächtigen sich einer superintelligenten künstlichen Intelligenz und nutzen sie, um Hochtechnologien herzustellen. - Umkehr: Der technologische Fortschritt wird radikal unterbunden und wir kehren zu einer prä-technologischen Gesellschaft im Stil der Amish zurück. - Selbstzerstörung: Superintelligenz wird nicht erreicht, weil sich die Menschheit vorher nuklear oder anders selbst vernichtet. - Egalitäres Utopia: Es gibt weder Superintelligenz noch Besitz, Menschen und kybernetische Organismen existieren friedlich nebeneinander. Max Tegmark bietet kluge und fundierte Zukunftsszenarien basierend auf seinen exklusiven Einblicken in die aktuelle Forschung zur künstlichen Intelligenz.

Evolution für Dummies

Author: Greg Krukonis,Tracy Barr

Publisher: John Wiley & Sons

ISBN: 3527669000

Category: Science

Page: 374

View: 2487

Von Darwin bis DNA – Ihr Wegweiser durch die Evolution Von Ihrem Körperbau bis zu Ihrem Verhalten bei der Partnerwahl – all Ihre vererbbaren Eigenschaften sind wie bei allen Lebewesen durch die Evolution bestimmt. Aber was ist Evolution überhaupt? Was treibt sie an? In diesem Buch erfahren Sie alles, was Sie über Evolution wissen müssen: Was genetische Variabilität ist, wie neue Arten entstehen, welchen Evolutionsvorteil soziales Verhalten bringt und vieles, vieles mehr. Greg Krukonis und Tracy Barr nehmen Sie mit auf eine spannende Reise durch die Geschichte der Evolution – von Darwins Theorie bis zu den neuesten wissenschaftlichen Erkenntnissen.

Eine kurze Geschichte der Menschheit

Author: Yuval Noah Harari

Publisher: DVA

ISBN: 364110498X

Category: History

Page: 528

View: 4049

Krone der Schöpfung? Vor 100 000 Jahren war der Homo sapiens noch ein unbedeutendes Tier, das unauffällig in einem abgelegenen Winkel des afrikanischen Kontinents lebte. Unsere Vorfahren teilten sich den Planeten mit mindestens fünf weiteren menschlichen Spezies, und die Rolle, die sie im Ökosystem spielten, war nicht größer als die von Gorillas, Libellen oder Quallen. Vor 70 000 Jahren dann vollzog sich ein mysteriöser und rascher Wandel mit dem Homo sapiens, und es war vor allem die Beschaffenheit seines Gehirns, die ihn zum Herren des Planeten und zum Schrecken des Ökosystems werden ließ. Bis heute hat sich diese Vorherrschaft stetig zugespitzt: Der Mensch hat die Fähigkeit zu schöpferischem und zu zerstörerischem Handeln wie kein anderes Lebewesen. Anschaulich, unterhaltsam und stellenweise hochkomisch zeichnet Yuval Harari die Geschichte des Menschen nach und zeigt alle großen, aber auch alle ambivalenten Momente unserer Menschwerdung.

Eine kurze Geschichte der Zeit

Author: Stephen Hawking

Publisher: Rowohlt Verlag GmbH

ISBN: 3644008612

Category: Science

Page: 272

View: 8941

Ist das Universum unendlich oder begrenzt? Hat die Raumzeit einen Anfang, den Urknall? Dehnt sie sich aus? Wird sie wieder in sich zusammenstürzen? Liefe die Zeit dann rückwärts? Welchen Platz im Universum nehmen wir ein? Und ist in den atemberaubenden Modellen der Kosmologen noch Platz für einen Gott? – Es sind existenzielle Fragen, mit denen sich Stephen Hawking befasst, Fragen, die Forschung und Lehre in den Zentren der modernen Physik ebenso bestimmen wie die Diskussion von Geisteswissenschaftlern. Dieses Meisterwerk eines Jahrhundert-Genies hat unsere Weltsicht verändert. Zugleich hat Stephen Hawking damit neue Maßstäbe für die Erklärung komplexer physikalischer Zusammenhänge gesetzt. In diesem Buch, weltweit inzwischen über zehn Millionen Mal verkauft, ist das Credo des großen Physikers enthalten und lebendig. «Der Physiker Stephen Hawking ist im Begriff, die Formel zu finden, die das Universum erklärt.» ZEIT-Magazin

Kurze Antworten auf große Fragen

Author: Stephen Hawking

Publisher: Klett-Cotta

ISBN: 3608115102

Category: Political Science

Page: 160

View: 549

Stephen Hawkings Vermächtnis In seinem letzten Buch gibt Stephen Hawking Antworten auf die drängendsten Fragen unserer Zeit und nimmt uns mit auf eine persönliche Reise durch das Universum seiner Weltanschauung. Seine Gedanken zu Ursprung und Zukunft der Menschheit sind zugleich eine Mahnung, unseren Heimatplaneten besser vor den Gefahren unserer Gegenwart zu schützen. Zugänglich und klar finden Sie in diesem Buch Hawkings Antworten auf die drängendsten Fragen unserer Zeit. - Warum gibt es uns Menschen überhaupt? - Und woher kommen wir? - Gibt es im Weltall andere intelligente Lebewesen? - Existiert Gott? - In welchem Zustand befindet sich unser Heimatplanet? - Werden wir auf der Erde überleben? - Retten oder zerstören uns Naturwissenschaften und Technik? - Hilft uns die künstliche Intelligenz, die Erde zu bewahren? - Können wir den Weltraum bevölkern? - Wie werden wir die Schwächsten – Kinder, Kranke, alte Menschen – schützen? - Wie werden wir unsere Kinder erziehen? Brillanter Physiker, revolutionärer Kosmologe, unerschütterlicher Optimist. Für Stephen Hawking bergen die Weiten des Universums nicht nur naturwissenschaftliche Geheimnisse. In seinem persönlichsten Buch beantwortet der Autor die großen Fragen des menschlichen Lebens und spricht die wichtigsten Themen unserer Zeit an. Zugänglich und klar erläutert er die Folgen des menschlichen Fortschritts – vom Klimawandel bis hin zu künstlicher Intelligenz – und diskutiert seine Gefahren. Hier finden Sie Hawkings Antworten auf die Urfragen der Menschheit. Ein großer Appell an politische Machthaber und jeden Einzelnen von uns, unseren bedrohten Heimatplaneten besser zu schützen.

Alexander von Humboldt und die Erfindung der Natur

Author: Andrea Wulf

Publisher: C. Bertelsmann Verlag

ISBN: 3641195500

Category: Biography & Autobiography

Page: 560

View: 1468

Was hat Alexander von Humboldt, der vor mehr als 150 Jahren starb, mit Klimawandel und Nachhaltigkeit zu tun? Der Naturforscher und Universalgelehrte, nach dem nicht nur unzählige Straßen, Pflanzen und sogar ein »Mare« auf dem Mond benannt sind, hat wie kein anderer Wissenschaftler unser Verständnis von Natur als lebendigem Ganzen, als Kosmos, in dem vom Winzigsten bis zum Größten alles miteinander verbunden ist und dessen untrennbarer Teil wir sind, geprägt. Die Historikerin Andrea Wulf stellt in ihrem vielfach preisgekrönten – so auch mit dem Bayerischen Buchpreis 2016 – Buch Humboldts Erfindung der Natur, die er radikal neu dachte, ins Zentrum ihrer Erkundungsreise durch sein Leben und Werk. Sie folgt den Spuren des begnadeten Netzwerkers und zeigt, dass unser heutiges Wissen um die Verwundbarkeit der Erde in Humboldts Überzeugungen verwurzelt ist. Ihm heute wieder zu begegnen, mahnt uns, seine Erkenntnisse endlich zum Maßstab unseres Handelns zu machen – um unser aller Überleben willen.

21 Lektionen für das 21. Jahrhundert

Author: Yuval Noah Harari

Publisher: C.H.Beck

ISBN: 3406727794

Category: History

Page: 459

View: 5023

Yuval Noah Harari ist der Weltstar unter den Historikern. In «Eine kurze Geschichte der Menschheit» erzählte er vom Aufstieg des Homo Sapiens zum Herrn der Welt. In «Homo Deus» ging es um die Zukunft unserer Spezies. Sein neues Buch schaut auf das Hier und Jetzt und konfrontiert uns mit den drängenden Fragen unserer Zeit. Wie unterscheiden wir Wahrheit und Fiktion im Zeitalter der Fake News? Was sollen wir unseren Kindern beibringen? Wie können wir in unserer unübersichtlichen Welt moralisch handeln? Wie bewahren wir Freiheit und Gleichheit im 21. Jahrhundert? Seit Jahrtausenden hat die Menschheit über den Fragen gebrütet, wer wir sind und was wir mit unserem Leben anfangen sollen. Doch jetzt setzen uns die heraufziehende ökologische Krise, die wachsende Bedrohung durch Massenvernichtungswaffen und der Aufstieg neuer disruptiver Technologien unter Zeitdruck. Bald schon wird irgendjemand darüber entscheiden müssen, wie wir die Macht nutzen, die künstliche Intelligenz und Biotechnologie bereit halten. Dieses Buch will möglichst viele Menschen dazu anregen, sich an den großen Debatten unserer Zeit zu beteiligen, damit die Antworten nicht von den blinden Kräften des Marktes gegeben werden.

Laudato si

Die Umwelt-Enzyklika des Papstes

Author: Franziskus (Papst),

Publisher: Verlag Herder GmbH

ISBN: 345180736X

Category: Religion

Page: 288

View: 5264

Mit großer Spannung wurde sie erwartet, auch von Nicht-Katholiken: Die Umwelt-Enzyklika von Papst Franziskus nimmt die heute entscheidenden Themen in den Blick; es geht um die geht um soziale, ökologische und politische Zusammenhänge. Wohl selten war ein päpstliches Schreiben so aktuell und brisant und vor allem relevant für alle Gesellschaftsschichten und Menschen weltweit. Mit "Laudato si" beweist Franziskus, dass die Kirche nach wie vor eine unverzichtbare Stimme im Diskurs zur Gestaltung der modernen Welt ist. Wer verstehen will, wie Papst und Kirche die großen Herausforderungen unserer Zeit bestehen wollen, kommt an diesem Werk nicht vorbei. Ein Muss für jeden, der an den drängenden Fragen unserer Zeit interessiert ist.

Homo Deus

Eine Geschichte von Morgen

Author: Yuval Noah Harari

Publisher: C.H.Beck

ISBN: 3406704026

Category: Social Science

Page: 576

View: 3534

In seinem Kultbuch „Eine kurze Geschichte der Menschheit“ erklärte Yuval Noah Harari, wie unsere Spezies die Erde erobern konnte. In „Homo Deus“ stößt er vor in eine noch verborgene Welt: die Zukunft. Was wird mit uns und unserem Planeten passieren, wenn die neuen Technologien dem Menschen gottgleiche Fähigkeiten verleihen – schöpferische wie zerstörerische – und das Leben selbst auf eine völlig neue Stufe der Evolution heben? Wie wird es dem Homo Sapiens ergehen, wenn er einen technikverstärkten Homo Deus erschafft, der sich vom heutigen Menschen deutlicher unterscheidet als dieser vom Neandertaler? Was bleibt von uns und der modernen Religion des Humanismus, wenn wir Maschinen konstruieren, die alles besser können als wir? In unserer Gier nach Gesundheit, Glück und Macht könnten wir uns ganz allmählich so weit verändern, bis wir schließlich keine Menschen mehr sind.

Bullshit Jobs

Vom wahren Sinn der Arbeit

Author: David Graeber

Publisher: Klett-Cotta

ISBN: 3608115064

Category: Political Science

Page: 560

View: 9568

Ein Bullshit-Job ist eine Beschäftigungsform, die so völlig sinnlos, unnötig oder schädlich ist, dass selbst der Arbeitnehmer ihre Existenz nicht rechtfertigen kann. Es geht also gerade nicht um Jobs, die niemand machen will, sondern um solche, die eigentlich niemand braucht. Im Zuge des technischen Fortschritts sind zahlreiche Arbeitsplätze durch Maschinen ersetzt worden. Trotzdem ist die durchschnittliche Arbeitszeit nicht etwa gesunken, sondern auf durchschnittlich 41,5 Wochenstunden gestiegen. Wie konnte es dazu kommen? David Graeber zeigt in seinem bahnbrechenden neuen Buch, warum immer mehr überflüssige Jobs entstehen und welche verheerenden Konsequenzen diese Entwicklung für unsere Gesellschaft hat. Im Jahr 1930 sagte der britische Ökonom John Maynard Keynes voraus, dass durch den technischen Fortschritt heute niemand mehr als 15 Stunden pro Woche arbeiten müsse. Fast ein Jahrhundert danach stellt David Graeber fest, dass die Gegenwart anders aussieht: Die durchschnittliche Arbeitszeit ist gestiegen und immer mehr Menschen üben Tätigkeiten aus, die unproduktiv und daher eigentlich überflüssig sind – als Immobilienmakler, Investmentbanker oder Unternehmensberater. Es sind Jobs, die keinen sinnvollen gesellschaftlichen Beitrag leisten. Es sind Bullshit-Jobs. Warum bezahlt eine Ökonomie solche Tätigkeiten, die sie nicht braucht? Wie ist es zu dieser Entwicklung gekommen? Und was können wir dagegen tun? David Graeber, einer der radikalsten politischen Denker unserer Zeit, geht diesem Phänomen auf den Grund. Ein packendes Plädoyer gegen die Ausweitung sinnloser Arbeit, die die moralischen Grundfesten unserer Gesellschaft ins Wanken bringt.

Mach, was Du willst

Design Thinking fürs Leben

Author: Bill Burnett,Dave Evans

Publisher: Ullstein eBooks

ISBN: 3843713634

Category: Self-Help

Page: 288

View: 4850

Design Thinking hilft, kreative Lösungen für komplexe Probleme zu finden. Die Autoren übertragen dieses Prinzip auf das Leben und die Berufswahl. Denke wie ein Designer: Stelle Fragen, suche Verbündete, mache Fehler, baue Prototypen, denke interdisziplinär – und werde zum Designer deines eigenen Lebens! Diese Ideen präsentieren die beiden Professoren seit sieben Jahren an der Stanford University,was zu chronisch überbuchten Kursen führt.

Der Report der Magd

Roman

Author: Margaret Atwood

Publisher: Piper ebooks

ISBN: 3492970591

Category: Fiction

Page: 400

View: 3415

Die provozierende Vision eines totalitären Staats, in dem Frauen keine Rechte haben: Die Dienerin Desfred besitzt etwas, was ihr alle Machthaber, Wächter und Spione nicht nehmen können, nämlich ihre Hoffnung auf ein Entkommen, auf Liebe, auf Leben ... Margaret Atwoods »Report der Magd« wurde zum Kultbuch einer ganzen Generation und von Volker Schlöndorff unter dem Titel »Die Geschichte der Dienerin« verfilmt.

Artificial Life

The Quest for a New Creation

Author: Steven Levy

Publisher: N.A

ISBN: 9780140231052

Category: Artificial intelligence

Page: 390

View: 9391

This book looks at artificial life science - A-Life, an important new area of scientific research involving the disciplines of microbiology, evolutionary theory, physics, chemistry and computer science. In the 1940s a mathematician named John von Neumann, a man with a claim to being the father of the modern computer, invented a hypothetical mathematical entity called a cellular automaton. His aim was to construct a machine that could reproduce itself. In the years since, with the development of hugely more sophisticated and complex computers, von Neumann's insights have gradually led to a point where scientists have created, within the wiring of these machines, something that so closely simulates life that it may, arguably, be called life. This machine reproduces itself, mutates, evolves through generations and dies.

Die Schlaf-Revolution

So ändern Sie Nacht für Nacht Ihr Leben

Author: Arianna Huffington

Publisher: Plassen Verlag

ISBN: 3864704073

Category: Health & Fitness

Page: 464

View: 4326

Unsere Gesellschaft hat ein Problem mit dem Thema Schlaf. Viel Schlaf wird assoziiert mit Faulheit. Wenig Schlaf gilt als Zeichen für Leistungsfähigkeit. Permanenter Schlafmangel ist eine Epidemie unserer Gesellschaft. Die Folgen für unsere Gesundheit, unsere Leistungsfähigkeit, unsere Beziehungen und unser Lebensglück sind dramatisch. Arianna Huffington sagt: "Wir brauchen eine Schlaf-Revolution!" Gestützt auf neueste wissenschaftliche Erkenntnisse erklärt sie: "Wir müssen unser Schlafverhalten grundsätzlich überdenken, um unser Leben wieder in den Griff zu bekommen." Wie beeinflusst moderne Technik unseren Schlaf? Welche Rolle spielen Medikamente? Diesen und vielen weiteren Fragen geht die Bestsellerautorin kompetent und sachkundig nach. Das Ergebnis wird unser Schlafverhalten revolutionieren.

Die soziale Eroberung der Erde

Eine biologische Geschichte des Menschen

Author: Edward O. Wilson

Publisher: C.H.Beck

ISBN: 3406645313

Category: Social Science

Page: 384

View: 2068

Woher kommen wir? Was sind wir? Wohin gehen wir? Der große Biologe E. O. Wilson entschlüsselt die Evolution des Menschen Die soziale Eroberung der Erde ist die Summe lebenslanger innovativer Forschung, die Krönung des Lebenswerkes von Edward O. Wilson. Seine weitreichende These: Die soziale Gruppe und nicht das egoistische Gen war der entscheidende Faktor der Menschwerdung. "Keinem außer Edward O. Wilson konnte eine derart brillante Synthese aus Biologie und Geisteswissenschaften gelingen, die Licht wirft auf den Ursprung von Sprache, Religion, Kunst und der gesamten menschlichen Kultur." Oliver Sacks "Eine große, doch einfache Fragestellung, überzeugende Erklärungen, eine meisterhafte Beherrschung der Wissenschaft und eine anschauliche, verständliche Darstellung einmal mehr hat E.O. Wilson ein Buch geschrieben mit den Qualitäten, die ihm Pulitzerpreise und ein Millionenpublikum eingebracht haben." Jared Diamond "Ein fabelhaftes Buch." Bill Clinton

The Origins of Life

The Origins of the Existential Sharing-in-Life

Author: Anna-Teresa Tymieniecka

Publisher: Springer Science & Business Media

ISBN: 9401140588

Category: Philosophy

Page: 502

View: 5820

Understanding life through its origins reveals the groundwork underlying the differentiations of its autonomous generative matrixes. Following the primogenital matrix of generation, the three generative matrixes of the specifically human sense of life establish humanness within the creative human condition as the existential sphere of sharing-in-life.