
The Origin of Life / The Future of Life

Author: Adam Rutherford

Publisher: Penguin UK

ISBN: 0141970227

Category: Science

Page: 272

View: 1560

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

The Future of Life

Author: Edward O. Wilson

Publisher: Vintage

ISBN: 0679768114

Category: Nature

Page: 229

View: 6746

Calls for decisive action to save Earth's endangered biological heritage, profiling threatened animals and plants and offering a program based on economic, ethical, and religious ideals for preserving our biosphere.

Universe in Creation

A New Understanding of the Big Bang and the Emergence of Life

Author: Roy R. Gould

Publisher: Harvard University Press

ISBN: 0674985044

Category: Science

Page: 256

View: 4348

We know the universe has a history, but does it also have a story of self-creation to tell? Yes, in Roy R. Gould’s account. He offers a compelling narrative of how the universe—with no instruction other than its own laws—evolved into billions of galaxies and gave rise to life, including humans who have been trying for millennia to comprehend it. Far from being a random accident, the universe is hard at work, extracting order from chaos. Making use of the best current science, Gould turns what many assume to be true about the universe on its head. The cosmos expands inward, not outward. Gravity can drive things apart, not merely together. And the universe seems to defy entropy as it becomes more ordered, rather than the other way around. Strangest of all, the universe is exquisitely hospitable to life, despite its being constructed from undistinguished atoms and a few unexceptional rules of behavior. Universe in Creation explores whether the emergence of life, rather than being a mere cosmic afterthought, may be written into the most basic laws of nature. Offering a fresh take on what brought the world—and us—into being, Gould helps us see the universe as the master of its own creation, not tethered to a singular event but burgeoning as new space and energy continuously stream into existence. It is a very old story, as yet unfinished, with plotlines that twist and churn through infinite space and time.


How Science Is Reinventing Life Itself

Author: Adam Rutherford

Publisher: Penguin

ISBN: 1617230111

Category: Science

Page: 278

View: 9271

"How scientists are closer than ever to not only uncovering the mystery of how life was created, but to replicating that moment Within the first billion years after this planet formed, a spark of life spontaneously ignited, turning inanimate chemicals into what we now would recognize as a living thing: a cell. Four billion years later, science has catalogued more than a million species. Science writer Adam Rutherford shows how unprecedented advances in our understanding of life have equipped us with the ability to create entirely new life-forms: goats that produce spider silk in their milk, bacteria that excrete diesel, genetic codes that identify and destroy cancer cells. This new synthetic biology is poised to offer radical new solutions to the crises of food shortage, pandemic disease, and climate change. By charting the history of our evolution, questioning what life really is, and identifying the milestones in our understanding of biological processes, Rutherford shows how this frontier of science will kickstart an industrial revolution that will dominate the rest of this century"--Provided by publisher.

The Meaning of Human Existence

Author: Edward O. Wilson

Publisher: W. W. Norton & Company

ISBN: 087140480X

Category: Science

Page: 192

View: 457

National Book Award Finalist. How did humanity originate and why does a species like ours exist on this planet? Do we have a special place, even a destiny in the universe? Where are we going, and perhaps, the most difficult question of all, "Why?" In The Meaning of Human Existence, his most philosophical work to date, Pulitzer Prize–winning biologist Edward O. Wilson grapples with these and other existential questions, examining what makes human beings supremely different from all other species. Searching for meaning in what Nietzsche once called "the rainbow colors" around the outer edges of knowledge and imagination, Wilson takes his readers on a journey, in the process bridging science and philosophy to create a twenty-first-century treatise on human existence—from our earliest inception to a provocative look at what the future of mankind portends. Continuing his groundbreaking examination of our "Anthropocene Epoch," which he began with The Social Conquest of Earth, described by the New York Times as "a sweeping account of the human rise to domination of the biosphere," here Wilson posits that we, as a species, now know enough about the universe and ourselves that we can begin to approach questions about our place in the cosmos and the meaning of intelligent life in a systematic, indeed, in a testable way. Once criticized for a purely mechanistic view of human life and an overreliance on genetic predetermination, Wilson presents in The Meaning of Human Existence his most expansive and advanced theories on the sovereignty of human life, recognizing that, even though the human and the spider evolved similarly, the poet's sonnet is wholly different from the spider's web. Whether attempting to explicate "The Riddle of the Human Species," "Free Will," or "Religion"; warning of "The Collapse of Biodiversity"; or even creating a plausible "Portrait of E.T.," Wilson does indeed believe that humanity holds a special position in the known universe. The human epoch that began in biological evolution and passed into pre-, then recorded, history is now more than ever before in our hands. Yet alarmed that we are about to abandon natural selection by redesigning biology and human nature as we wish them, Wilson soberly concludes that advances in science and technology bring us our greatest moral dilemma since God stayed the hand of Abraham.


The Origin of Matter, Space, Time, and Life.

Author: Troy Edward Lawrence DC

Publisher: Troy Lawrence Publishing

ISBN: 9781943185009


Page: 434

View: 1527

In Origins, Dr. Lawrence explains many mysteries involving the origins of all things, including an exciting twist on the extinction of the dinosaurs. Dr. Lawrence provides unique answers for a whole range of questions about creation, including: "What environmental conditions allowed the dinosaurs to thrive?" "How did men and women live to be 900+ years of age in ancient times?" "How did the atmosphere form?" "How old is the earth and the universe?" "How did the universe expand?" "How did everything come into existence?" Whether you are an atheist or theist, evolutionist or creationist, educated or not, this book is for you and will benefit you. Table of Contents Preface5 Introduction5 ChapterPage Section I How Young is the Earth? 1Gravity8 2The Effects of Weaker Gravity on Life39 3The Canopy of Salt Water53 4Climate70 5Oxygen Concentration 78 6Land Was More Plentiful in the Past87 7Meteors, Asteroids, and Comets91 8Earth's Spin at Origins 99 9The Flood100 10No Deserts Before the Flood 108 11When and What Caused the Polar Ice Caps and the Ice Age?120 Section II How Old is the Earth? 12Tectonic Plates and River Deltas132 13Radioactive Isotopic Dating142 14Carbon-14 Dating151 15Viscosity of Rocks153 16Moon Dust154 17The Magnetic Field156 18Polystrata, Petrification, and Fossilization 159 19Distance to the Moon166 20Tyrannosaurus Rex Soft Tissue Found170 21Layers of the Earth171 22Transitional Fossils186 23Light197 24Humans Lived 900+ Years and Adaptation from Origins203 25What Happened to Dinosaurs?218 26The Big Bang Versus the Bible230 27The Big Bang Versus Physics238 28Evolution Versus Mathematics250 29Evolution Versus Physics264 30Evolution Versus Science270 31Evolution Versus the Bible292 Section III The Seven Days of Creation 32The First Day297 33The Second Day324 34The Third Day332 35The Fourth Day347 36The Fifth Day361 37The Sixth Day369 38The Seventh Day383 39Life in the Beginning Before Sin392 40Seven-Day Creation Versus Seven-Eon Creation 400 41The "Gap" Theory Between Verse 1 and 2 of Gen. 1408

Creation and the Persistence of Evil

The Jewish Drama of Divine Omnipotence

Author: Jon Douglas Levenson

Publisher: Princeton University Press

ISBN: 9780691029504

Category: Religion

Page: 182

View: 9479

This paperback edition brings to a wide audience one of the most innovative and meaningful models of God for this post-Auschwitz era. In a thought-provoking return to the original Hebrew conception of God, which questions accepted conceptions of divine omnipotence, Jon Levenson defines God's authorship of the world as a consequence of his victory in his struggle with evil. He traces a flexible conception of God to the earliest Hebrew sources, arguing, for example, that Genesis 1 does not describe the banishment of evil but the attempt to contain the menace of evil in the world, a struggle that continues today.This paperback edition brings to a wide audience one of the most innovative and meaningful models of God for this post-Auschwitz era. In a thought-provoking return to the original Hebrew conception of God, which questions accepted conceptions of divine omnipotence, Jon Levenson defines God's authorship of the world as a consequence of his victory in his struggle with evil. He traces a flexible conception of God to the earliest Hebrew sources, arguing, for example, that Genesis 1 does not describe the banishment of evil but the attempt to contain the menace of evil in the world, a struggle that continues today.

Faith, Form, and Time

What the Bible Teaches and Science Confirms about Creation and the Age of the Universe

Author: Kurt P. Wise

Publisher: B&H Publishing Group

ISBN: 0805424628

Category: Religion

Page: 287

View: 699

Presents evidence that the universe was created in six days approximately six thousand years ago, challenging Darwinian theories of evolution while demonstrating how evolutionist issues are answered by biblical and scientific data. Original.

The Big Picture

Author: Sean Carroll

Publisher: Oneworld Publications

ISBN: 1780746075

Category: Science

Page: 464

View: 7419

Where are we? Who are we? Do our beliefs, hopes and dreams mean anything out there in the void? Can human purpose and meaning ever fit into a scientific worldview? Acclaimed award-winning author Sean Carroll brings his extraordinary intellect to bear on the realms of knowledge, the laws of nature and the most profound questions about life, death and our place in it all. In a dazzlingly unique presentation, Carroll takes us through the scientific revolution’s avalanche of discoveries, from Darwin and Einstein to the origins of life, consciousness and the universe itself. Delving into the way the world works at the quantum, cosmic and human levels, he reveals how human values relate to scientific reality. An extraordinary synthesis of cosmos-sprawling science and profound thought, The Big Picture is Carroll’s quest to explain our world. Destined to sit alongside the works of our greatest thinkers, from Stephen Hawking and Carl Sagan to Daniel Dennett and E. O. Wilson, this book shows that while our lives may be forever dwarfed by the immensity of the universe, they can be redeemed by our capacity to comprehend it and give it meaning.

Life 3.0

Being Human in the Age of Artificial Intelligence

Author: Max Tegmark

Publisher: Vintage

ISBN: 1101946601

Category: Technology & Engineering

Page: 384

View: 9801

New York Times Best Seller How will Artificial Intelligence affect crime, war, justice, jobs, society and our very sense of being human? The rise of AI has the potential to transform our future more than any other technology—and there’s nobody better qualified or situated to explore that future than Max Tegmark, an MIT professor who’s helped mainstream research on how to keep AI beneficial. How can we grow our prosperity through automation without leaving people lacking income or purpose? What career advice should we give today’s kids? How can we make future AI systems more robust, so that they do what we want without crashing, malfunctioning or getting hacked? Should we fear an arms race in lethal autonomous weapons? Will machines eventually outsmart us at all tasks, replacing humans on the job market and perhaps altogether? Will AI help life flourish like never before or give us more power than we can handle? What sort of future do you want? This book empowers you to join what may be the most important conversation of our time. It doesn’t shy away from the full range of viewpoints or from the most controversial issues—from superintelligence to meaning, consciousness and the ultimate physical limits on life in the cosmos.

The Story of Earth

The First 4.5 Billion Years, from Stardust to Living Planet

Author: Robert M. Hazen

Publisher: Penguin

ISBN: 0143123645

Category: Science

Page: 320

View: 940

The author of the best-selling Science Matters outlines a radical new approach to geologic history that advances controversial theories that the Earth evolved and that life evolved from minerals, assessing supportive findings while explaining the impact of human actions.

The Cosmic Hologram

In-formation at the Center of Creation

Author: Jude Currivan

Publisher: Simon and Schuster

ISBN: 1620556618

Category: Body, Mind & Spirit

Page: 272

View: 3762

How holographic patterns of information underlie our physical reality • Includes myriad evidence from a wide range of cutting-edge scientific discoveries showing our Universe is an interconnected hologram of information • Explains how consciousness is a major component of the cosmic hologram of information, making us both manifestations and co-creators of our reality • Reconciles Quantum Mechanics and Einstein’s Theory of Relativity by showing that energy-matter and space-time are complementary expressions of information Our understanding of the Universe is about to transform at all levels, from the tiniest Planck scale to the vast reaches of space. Recent scientific discoveries show that the information that upholds all of our modern technologies is exactly the same as the universal in-formation that underpins, pervades, and is all we call physical reality. Exploring how information is more fundamental than energy, matter, space, or time, Jude Currivan, Ph.D., examines the latest research across many fields of study and many scales of existence to show how our Universe is in-formed and holographically manifested. She explains how the fractal in-formational patterns that guide behavior at the atomic level also guide the structure of galactic clusters in space. She demonstrates how the in-formational relationships that underlie earthquakes are the same as those that play out during human conflicts. She shows how cities grow in the same in-formational ways that galaxies evolve and how the dynamic in-formational forms that pervade ecosystems are identical to the informational structures of the Internet and our social behaviors. Demonstrating how information is physically real, the author explores how consciousness connects us to the many interconnected layers of universal in-formation, making us both manifestations and co-creators of the cosmic hologram of reality. She explains how Quantum Mechanics and Einstein’s Theory of Relativity can at last be reconciled if we consider energy-matter and space-time as complementary expressions of information, and she explores how the cosmic hologram underlies the true origin of species and our own evolution. Concurring too with ancient spiritual wisdom, the author offers solid evidence that consciousness is not something we “have” but the fundamental nature of what we and the entire Universe are. With this understanding, we can each transform our own lives and help co-create and in-form the world around us.

A Brief History of Everyone Who Ever Lived

The Stories in Our Genes

Author: Adam Rutherford

Publisher: Weidenfeld & Nicolson

ISBN: 9781780229072


Page: 432

View: 8986

This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about human history, and what history can now tell us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be.

Project Future

The Inside Story Behind the Creation of Disney World

Author: Chad Denver Emerson

Publisher: N.A

ISBN: 9780615347776

Category: Travel

Page: 185

View: 1042

The Walt Disney World Resort near Orlando, Florida is one of the world's most famous vacation destinations. This iconic resort is now located in what once was thousands of acres of swamp and marshland. Through spy-like moves and innovative strategies, Walt Disney and his cadre of creative leaders turned this massive swamp land into today's Disney World. This books shares the amazing behind the scenes story of how Disney's Florida resort, code-named Project Future, rose from the marshes of Central Florida to become one of the world's most popular theme park resorts.


A Brief History of Humankind

Author: Yuval Noah Harari

Publisher: Harper Collins

ISBN: 0062316109

Category: Science

Page: 464

View: 2412

New York Times Bestseller A Summer Reading Pick for President Barack Obama, Bill Gates, and Mark Zuckerberg From a renowned historian comes a groundbreaking narrative of humanity’s creation and evolution—a #1 international bestseller—that explores the ways in which biology and history have defined us and enhanced our understanding of what it means to be “human.” One hundred thousand years ago, at least six different species of humans inhabited Earth. Yet today there is only one—homo sapiens. What happened to the others? And what may happen to us? Most books about the history of humanity pursue either a historical or a biological approach, but Dr. Yuval Noah Harari breaks the mold with this highly original book that begins about 70,000 years ago with the appearance of modern cognition. From examining the role evolving humans have played in the global ecosystem to charting the rise of empires, Sapiens integrates history and science to reconsider accepted narratives, connect past developments with contemporary concerns, and examine specific events within the context of larger ideas. Dr. Harari also compels us to look ahead, because over the last few decades humans have begun to bend laws of natural selection that have governed life for the past four billion years. We are acquiring the ability to design not only the world around us, but also ourselves. Where is this leading us, and what do we want to become? Featuring 27 photographs, 6 maps, and 25 illustrations/diagrams, this provocative and insightful work is sure to spark debate and is essential reading for aficionados of Jared Diamond, James Gleick, Matt Ridley, Robert Wright, and Sharon Moalem.

A History of Future Cities

Author: Daniel Brook

Publisher: W. W. Norton & Company

ISBN: 0393078124

Category: Social Science

Page: 457

View: 3678

An exploration of four cities that reflect a blend of Eastern and Western cultures traces the historical threads connecting St. Petersburg, Shanghai, Mumbai, and Dubai while discussing their conflicted embrace of modernity.

The First Book of Moses, Called Genesis

Authorized King James Version

Author: N.A

Publisher: Grove/Atlantic, Inc.

ISBN: 9780802136107

Category: Bibles

Page: 126

View: 4054

The publication of the King James version of the Bible, translated between 1603 and 1611, coincided with an extraordinary flowering of English literature and is universally acknowledged as the greatest influence on English-language literature in history. Now, world-class literary writers introduce the book of the King James Bible in a series of beautifully designed, small-format volumes. The introducers' passionate, provocative, and personal engagements with the spirituality and the language of the text make the Bible come alive as a stunning work of literature and remind us of its overwhelming contemporary relevance.

The One Device

The Secret History of the iPhone

Author: Brian Merchant

Publisher: Little, Brown

ISBN: 0316546119

Category: Business & Economics

Page: 416

View: 1682

The secret history of the invention that changed everything-and became the most profitable product in the world. NATIONAL BESTSELLERShortlisted for the Financial Times Business Book of the Year Award One of the Best Business Books of 2016 - CNBC, Bloomberg, 1-800-CEO-Read "The One Device is a tour de force, with a fast-paced edge and heaps of analytical insight." -Ashlee Vance, New York Times bestselling author of Elon Musk "A stunning book. You will never look at your iPhone the same way again." -Dan Lyons, New York Times bestselling author of Disrupted Odds are that as you read this, an iPhone is within reach. But before Steve Jobs introduced us to "the one device," as he called it, a cell phone was merely what you used to make calls on the go. How did the iPhone transform our world and turn Apple into the most valuable company ever? Veteran technology journalist Brian Merchant reveals the inside story you won't hear from Cupertino-based on his exclusive interviews with the engineers, inventors, and developers who guided every stage of the iPhone's creation. This deep dive takes you from inside One Infinite Loop to 19th century France to WWII America, from the driest place on earth to a Kenyan pit of toxic e-waste, and even deep inside Shenzhen's notorious "suicide factories." It's a firsthand look at how the cutting-edge tech that makes the world work-touch screens, motion trackers, and even AI-made their way into our pockets. The One Device is a roadmap for design and engineering genius, an anthropology of the modern age, and an unprecedented view into one of the most secretive companies in history. This is the untold account, ten years in the making, of the device that changed everything.

Creation Care

A Biblical Theology of the Natural World

Author: Douglas J. Moo,Jonathan A. Moo

Publisher: Zondervan

ISBN: 0310416558

Category: Religion

Page: 256

View: 2871

From Genesis to Revelation, the Bible reveals a God whose creative power and loving care embrace all that exists, from earth and sky and sea to every creeping, crawling, swimming, and flying creature. Yet the significance of the Bible’s extensive teaching about the natural world is easily overlooked by Christians accustomed to focusing only on what the Bible says about God’s interaction with human beings. In Creation Care, part of the Biblical Theology for Life series, father and son team Douglas and Jonathan Moo invite readers to open their Bibles afresh to explore the place of the natural world within God’s purposes and to celebrate God’s love as displayed in creation and new creation. Following the contours of the biblical storyline, they uncover answers to questions such as: What is the purpose of the non-human creation? Can a world with things like predators, parasites, and natural disasters still be the ‘good’ world described in Genesis 1? What difference does the narrative of the ‘Fall’ make for humankind’s responsibility to rule over other creatures? Does Israel’s experience on the land have anything to teach Christians about their relationship with the earth? What difference does Jesus make for our understanding of the natural world? How does our call to care for creation fit within the hope for a new heaven and a new earth? What is unique about Christian creation care compared with other approaches to ‘environmental’ issues? How does creation care fit within the charge to proclaim the gospel and care for the poor? In addition to providing a comprehensive biblical theology of creation care, they probe behind the headlines and politicized rhetoric about an ‘environmental crisis’ and climate change to provide a careful and judicious analysis of the most up-to-date scientific data about the state of our world. They conclude by setting forth a bold framework and practical suggestions for an effective and faithful Christian response to the scriptural teaching about the created world. But rather than merely offering a response to environmental concerns, Creation Care invites readers into a joyful vision of the world as God’s creation in which they can rediscover who they truly are as creatures called to love and serve the Creator and to delight in all he has made.


Its Beginning and Your Origin: Who We Are and Where We Came From

Author: Jay Essex

Publisher: CreateSpace

ISBN: 9781511412421


Page: 134

View: 6177

This book finally explains the actual birth of Creation in both its physical and metaphysical forms. It includes how the first being came into existence, all the Spirit beings (sentient energy) which came from it, and the reason for them. It further explains how the physical Universe was created, how dimensions were formed, and the chronological order of these events. No where else will you find the answers to life's most basic questions whose answers have remained elusive throughout time. It even explains which came first, the chicken or the egg. Is there a being that we call God, a heaven or hell, and have we had any lives other than the ones we're having now? How is a Soul put into a body, who does it, where does it come from and where does it go? What is a Soul anyway? Does anyone run our lives and if so, how and how much of them? What different types of Spirit inhabit the different physical bodies we see every day, and are there others we don't see? This book is about the how and why of the birth of all Creation, who's in it, how they get along, why it was made this way, how and why it's changing, and what's coming very soon. The Author, Jay Essex, is known worldwide for his knowledge of Creation, ability to talk to all Spirit and using his energy to enhance and enlarge people's brains and abilities across the planet all from his home in Duluth, Georgia. Jay is world renowned for enhancing other people's abilities as well as their brains which tend to physically grow in size. He does this remotely from his house in Georgia. Jay says we're all family and it's time we realized it.