Creation

The Origin of Life / The Future of Life

Author: Adam Rutherford

Publisher: Penguin UK

ISBN: 0141970227

Category: Science

Page: 272

View: 661

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Evolution für Dummies

Author: Greg Krukonis,Tracy Barr

Publisher: John Wiley & Sons

ISBN: 3527669000

Category: Science

Page: 374

View: 7711

Von Darwin bis DNA – Ihr Wegweiser durch die Evolution Von Ihrem Körperbau bis zu Ihrem Verhalten bei der Partnerwahl – all Ihre vererbbaren Eigenschaften sind wie bei allen Lebewesen durch die Evolution bestimmt. Aber was ist Evolution überhaupt? Was treibt sie an? In diesem Buch erfahren Sie alles, was Sie über Evolution wissen müssen: Was genetische Variabilität ist, wie neue Arten entstehen, welchen Evolutionsvorteil soziales Verhalten bringt und vieles, vieles mehr. Greg Krukonis und Tracy Barr nehmen Sie mit auf eine spannende Reise durch die Geschichte der Evolution – von Darwins Theorie bis zu den neuesten wissenschaftlichen Erkenntnissen.

Leben 3.0

Mensch sein im Zeitalter Künstlicher Intelligenz

Author: Max Tegmark

Publisher: Ullstein Buchverlage

ISBN: 3843716706

Category: Social Science

Page: 528

View: 5966

Die Nobelpreis-Schmiede Massachusetts Institute of Technology ist der bedeutendste technologische Think Tank der USA. Dort arbeitet Professor Max Tegmark mit den weltweit führenden Entwicklern künstlicher Intelligenz zusammen, die ihm exklusive Einblicke in ihre Labors gewähren. Die Erkenntnisse, die er daraus zieht, sind atemberaubend und zutiefst verstörend zugleich. Neigt sich die Ära der Menschen dem Ende zu? Der Physikprofessor Max Tegmark zeigt anhand der neusten Forschung, was die Menschheit erwartet. Hier eine Auswahl möglicher Szenarien: - Eroberer: Künstliche Intelligenz übernimmt die Macht und entledigt sich der Menschheit mit Methoden, die wir noch nicht einmal verstehen. - Der versklavte Gott: Die Menschen bemächtigen sich einer superintelligenten künstlichen Intelligenz und nutzen sie, um Hochtechnologien herzustellen. - Umkehr: Der technologische Fortschritt wird radikal unterbunden und wir kehren zu einer prä-technologischen Gesellschaft im Stil der Amish zurück. - Selbstzerstörung: Superintelligenz wird nicht erreicht, weil sich die Menschheit vorher nuklear oder anders selbst vernichtet. - Egalitäres Utopia: Es gibt weder Superintelligenz noch Besitz, Menschen und kybernetische Organismen existieren friedlich nebeneinander. Max Tegmark bietet kluge und fundierte Zukunftsszenarien basierend auf seinen exklusiven Einblicken in die aktuelle Forschung zur künstlichen Intelligenz.

Eine kurze Geschichte der Menschheit

Author: Yuval Noah Harari

Publisher: DVA

ISBN: 364110498X

Category: History

Page: 528

View: 5733

Krone der Schöpfung? Vor 100 000 Jahren war der Homo sapiens noch ein unbedeutendes Tier, das unauffällig in einem abgelegenen Winkel des afrikanischen Kontinents lebte. Unsere Vorfahren teilten sich den Planeten mit mindestens fünf weiteren menschlichen Spezies, und die Rolle, die sie im Ökosystem spielten, war nicht größer als die von Gorillas, Libellen oder Quallen. Vor 70 000 Jahren dann vollzog sich ein mysteriöser und rascher Wandel mit dem Homo sapiens, und es war vor allem die Beschaffenheit seines Gehirns, die ihn zum Herren des Planeten und zum Schrecken des Ökosystems werden ließ. Bis heute hat sich diese Vorherrschaft stetig zugespitzt: Der Mensch hat die Fähigkeit zu schöpferischem und zu zerstörerischem Handeln wie kein anderes Lebewesen. Anschaulich, unterhaltsam und stellenweise hochkomisch zeichnet Yuval Harari die Geschichte des Menschen nach und zeigt alle großen, aber auch alle ambivalenten Momente unserer Menschwerdung.

Big History

Die Geschichte der Welt - Vom Urknall bis zur Zukunft der Menschheit

Author: David Christian

Publisher: Carl Hanser Verlag GmbH Co KG

ISBN: 3446261427

Category: History

Page: 400

View: 7068

Der Big Bang war der heißeste Augenblick der Weltgeschichte. Der Rest ist Abkühlung. Und die hatte Folgen: Atome und Sterne entstanden, die Erde und wir. Eingebettet in die Geschichte des Universums ist auch die Geschichte der Menschheit. David Christian erzählt die Historie der Welt anhand von acht Schwellenmomenten: von der Entstehung des Lebens bis zur Fotosynthese, von der Sprache bis zum menschgemachten Klimawandel. Sein Buch ist eine brillante Synthese der Erkenntnisse aus Astronomie, Biologie, Chemie und Physik. Und eine atemberaubende moderne Ursprungsgeschichte, die mit einem Ausblick auf die Zukunft endet, in der wir endlich die Verantwortung für den Planeten Erde übernehmen müssen.

Comets And Their Origin

The Tools To Decipher A Comet

Author: Uwe Meierhenrich

Publisher: John Wiley & Sons

ISBN: 3527412794

Category: Science

Page: 352

View: 5711

Divided into two parts, the first four chapters of Comets and their Origin refer to comets and their formation in general, describing cometary missions, comet remote observations, astrochemistry, artificial comets, and the chirality phenomenon. The second part covers the cometary ROSETTA mission, its launch, journey, scientific objectives, and instrumentations, as well as the landing scenario on a cometary nucleus. Along the way, the author presents general questions concerning the origin of terrestrial water and the molecular beginnings of life on Earth, as well as how the instruments used on a space mission like ROSETTA can help answer them. The text concludes with a chapter on what scientists expect from the ROSETTA mission and how its data will influence our life on Earth. As a result, the author elucidates highly topical and fascinating knowledge to scientists and students of various scientific backgrounds, allowing them to work with ROSETTA's data.

The Origins of Life

The Origins of the Existential Sharing-in-Life

Author: Anna-Teresa Tymieniecka

Publisher: Springer Science & Business Media

ISBN: 9401140588

Category: Philosophy

Page: 502

View: 4107

Understanding life through its origins reveals the groundwork underlying the differentiations of its autonomous generative matrixes. Following the primogenital matrix of generation, the three generative matrixes of the specifically human sense of life establish humanness within the creative human condition as the existential sphere of sharing-in-life.

Sterblich sein

Was am Ende wirklich zählt. Über Würde, Autonomie und eine angemessene medizinische Versorgung

Author: Atul Gawande

Publisher: S. Fischer Verlag

ISBN: 3104035849

Category: Self-Help

Page: 336

View: 9193

Ein Buch über das Sterben, das das Leben lehrt Die Medizin scheint über Krankheit und Tod zu triumphieren, doch sterben wir so trostlos wie nie zuvor. Der Bestsellerautor und renommierte Arzt Atul Gawande schreibt in seinem beeindruckenden Buch über das, was am Ende unseres Lebens wirklich zählt. Ungewöhnlich offen spricht er darüber, was es bedeutet, alt zu werden, wie man mit Gebrechen und Krankheiten umgehen kann und was wir an unserem System ändern müssen, um unser Leben würdevoll zu Ende zu bringen. Ein mutiges und weises Buch eines großartigen Autors, voller Geschichten und eigener Erfahrungen, das uns hilft, die Geschichte unseres Lebens gut zu Ende zu erzählen. »Dieses Buch ist nicht nur weise und sehr bewegend, sondern gerade in unserer Zeit unbedingt notwendig und sehr aufschlussreich.« Oliver Sacks »Die medizinische Betreuung ist mehr auf Heilung ausgelegt als auf das Sterben. Dies ist Atuls Gawandes stärkstes und bewegendstes Buch.« Malcolm Gladwell

A Crack in Creation

The New Power to Control Evolution

Author: Jennifer Doudna,Samuel Sternberg

Publisher: Random House

ISBN: 1473524199

Category: Science

Page: 304

View: 8126

Jennifer Doudna, the world-famous scientist behind CRISPR, ‘one of the most monumental discoveries in biology’ (New York Times), explains its discovery, describes its power to reshape the future of all life and warns of its use. 'Urgent, riveting and endlessly fascinating, this book is destined to become an instant classic. Read it if you want to understand our biological future' Siddhartha Mukherjee 'In this wonderful book ... Doudna’s and Sternberg’s simple but compelling exploration of this hugely important subject offers and excellent overview of this startling and unprecedented discovery' Literary Review A handful of discoveries have changed the course of human history. This book is about the most recent and potentially the most powerful and dangerous of them all. It is an invention that allows us to rewrite the genetic code that shapes and controls all living beings with astonishing accuracy and ease. Thanks to it, the dreams of genetic manipulation have become a stark reality: the power to cure disease and alleviate suffering, to create new sources of food and energy, as well as to re-design any species, including humans, for our own ends. Jennifer Doudna is the co-inventor of this technology - known as CRISPR - and a scientist of worldwide renown. Writing with fellow researcher Samuel Sternberg, here she provides the definitive account of her discovery, explaining how this wondrous invention works and what it is capable of. She also asks us to consider what our new-found power means: how do we enjoy its unprecedented benefits while avoiding its equally unprecedented dangers? The future of humankind – and of all life on Earth – is at stake. This book is an essential guide to the path that now lies ahead. 'A scientific thriller and a gripping read by a brilliant scientist' Venki Ramakrishnan

Laudato si

Die Umwelt-Enzyklika des Papstes

Author: Franziskus (Papst),

Publisher: Verlag Herder GmbH

ISBN: 345180736X

Category: Religion

Page: 288

View: 9197

Mit großer Spannung wurde sie erwartet, auch von Nicht-Katholiken: Die Umwelt-Enzyklika von Papst Franziskus nimmt die heute entscheidenden Themen in den Blick; es geht um die geht um soziale, ökologische und politische Zusammenhänge. Wohl selten war ein päpstliches Schreiben so aktuell und brisant und vor allem relevant für alle Gesellschaftsschichten und Menschen weltweit. Mit "Laudato si" beweist Franziskus, dass die Kirche nach wie vor eine unverzichtbare Stimme im Diskurs zur Gestaltung der modernen Welt ist. Wer verstehen will, wie Papst und Kirche die großen Herausforderungen unserer Zeit bestehen wollen, kommt an diesem Werk nicht vorbei. Ein Muss für jeden, der an den drängenden Fragen unserer Zeit interessiert ist.

The Creation of the Future

The Role of the American University

Author: Frank Harold Trevor Rhodes

Publisher: Cornell University Press

ISBN: 9780801439377

Category: Education

Page: 265

View: 6767

The president emeritus of Cornell University speak out on the role of academia in society, discussing, tenure, unionization, affirmative action, liberal arts, and many other important issues related to the status of higher education in America.

Biblical Theology

Introducing the Conversation

Author: Leo Perdue

Publisher: Abingdon Press

ISBN: 142673199X

Category: Religion

Page: N.A

View: 4922

One of the thorniest problems in theological study is the relationship between biblical studies on the one hand, and constructive theology on the other. Theologians know that the Bible is the core source document for theological construction, and hence that they must be in conversation with the best in critical study of Scripture. For many biblical scholars, the point of what they do is to help the biblical text speak to today’s church and world, and hence they would do well to be in conversation with contemporary theology. Yet too often the two groups fail to engage each other’s work in significant and productive ways. The purpose of the Library of Biblical Theology, and this introductory volume to it, is to bring the worlds of biblical scholarship and constructive theology together. It will do so by reviving biblical theology as a discipline that describes the faith of the biblical periods on the one hand, and on the other hand articulates normative understandings of modern faith and practice. In this volume the authors begin by providing an overview of the history and possible future of biblical theology. They introduce biblical theology as a fundamentally contrastive discipline, one that is neither dogmatic theology (seeking to explain the official teachings of a particular Christian tradition), nor is it a purely historical approach to Scripture, eschewing questions of the Bible’s contemporary message and meaning. Rather, biblical theology takes seriously both the need to understand the message of Scripture in its particular historical context, and the need to address that message to questions that confront contemporary human life.

Eine kurze Geschichte der Zeit

Author: Stephen Hawking

Publisher: Rowohlt Verlag GmbH

ISBN: 3644008612

Category: Science

Page: 272

View: 8058

Ist das Universum unendlich oder begrenzt? Hat die Raumzeit einen Anfang, den Urknall? Dehnt sie sich aus? Wird sie wieder in sich zusammenstürzen? Liefe die Zeit dann rückwärts? Welchen Platz im Universum nehmen wir ein? Und ist in den atemberaubenden Modellen der Kosmologen noch Platz für einen Gott? – Es sind existenzielle Fragen, mit denen sich Stephen Hawking befasst, Fragen, die Forschung und Lehre in den Zentren der modernen Physik ebenso bestimmen wie die Diskussion von Geisteswissenschaftlern. Dieses Meisterwerk eines Jahrhundert-Genies hat unsere Weltsicht verändert. Zugleich hat Stephen Hawking damit neue Maßstäbe für die Erklärung komplexer physikalischer Zusammenhänge gesetzt. In diesem Buch, weltweit inzwischen über zehn Millionen Mal verkauft, ist das Credo des großen Physikers enthalten und lebendig. «Der Physiker Stephen Hawking ist im Begriff, die Formel zu finden, die das Universum erklärt.» ZEIT-Magazin

Der Report der Magd

Roman

Author: Margaret Atwood

Publisher: Piper ebooks

ISBN: 3492970591

Category: Fiction

Page: 400

View: 6310

Die provozierende Vision eines totalitären Staats, in dem Frauen keine Rechte haben: Die Dienerin Desfred besitzt etwas, was ihr alle Machthaber, Wächter und Spione nicht nehmen können, nämlich ihre Hoffnung auf ein Entkommen, auf Liebe, auf Leben ... Margaret Atwoods »Report der Magd« wurde zum Kultbuch einer ganzen Generation und von Volker Schlöndorff unter dem Titel »Die Geschichte der Dienerin« verfilmt.

Homo Deus

Eine Geschichte von Morgen

Author: Yuval Noah Harari

Publisher: C.H.Beck

ISBN: 3406704026

Category: Social Science

Page: 576

View: 8870

In seinem Kultbuch „Eine kurze Geschichte der Menschheit“ erklärte Yuval Noah Harari, wie unsere Spezies die Erde erobern konnte. In „Homo Deus“ stößt er vor in eine noch verborgene Welt: die Zukunft. Was wird mit uns und unserem Planeten passieren, wenn die neuen Technologien dem Menschen gottgleiche Fähigkeiten verleihen – schöpferische wie zerstörerische – und das Leben selbst auf eine völlig neue Stufe der Evolution heben? Wie wird es dem Homo Sapiens ergehen, wenn er einen technikverstärkten Homo Deus erschafft, der sich vom heutigen Menschen deutlicher unterscheidet als dieser vom Neandertaler? Was bleibt von uns und der modernen Religion des Humanismus, wenn wir Maschinen konstruieren, die alles besser können als wir? In unserer Gier nach Gesundheit, Glück und Macht könnten wir uns ganz allmählich so weit verändern, bis wir schließlich keine Menschen mehr sind.

Information Theory, Evolution, and the Origin of Life

Author: Hubert P. Yockey

Publisher: Cambridge University Press

ISBN: 9780521802932

Category: Computers

Page: 259

View: 3705

Information Theory, Evolution and the Origin of Life presents a timely introduction to the use of information theory and coding theory in molecular biology. The genetical information system, because it is linear and digital, resembles the algorithmic language of computers. George Gamow pointed out that the application of Shannon's information theory breaks genetics and molecular biology out of the descriptive mode into the quantitative mode and Dr Yockey develops this theme, discussing how information theory and coding theory can be applied to molecular biology. He discusses how these tools for measuring the information in the sequences of the genome and the proteome are essential for our complete understanding of the nature and origin of life. The author writes for the computer competent reader who is interested in evolution and the origins of life.

The Future of the Universe and the Future of Our Civilization

Budapest-Debrecen, Hungary, 2-6 July 1999

Author: V. Burdyuzha,G. Kohzin

Publisher: World Scientific

ISBN: 9789810242640

Category: Science

Page: 387

View: 483

The first of its kind, the Symposium on the Future of the Universe and the Future of our Civilization examined the current status and future evolution of the Universe, the Galaxy, the stars and the Sun. Among the major subjects of discussion were: (1) How was our Universe born? (2) How do the Sun and the stars evolve? (3) What is the destiny of the solar system and the Universe? (4) What are the origins and the future of the biosphere of the Earth? (5) What are the prospects of survival of human civilization? Special attention was devoted to analysis of humanitarian and philosophical problems of evolution of humankind on the planet Earth and in the Universe. Among them were methodological, economic, sociological and medical aspects of the progress of civilization. Scientists from different countries put forward some practical proposals, including those describing the possible ways out of the systemic crisis of our civilization.